| CARD ID | 781 | |
| Type of strain | Transgenic. | |
| Strain name | B6;C3H-Tg(K19-Wnt5a/K19-Ptgs2/K19-Ptges)#5,7 | |
| Internal Code | K19-Wnt5a/C2mE | |
| Submitter | Masanobu Oshima | |
| Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Cancer Research Institute, Kanazawa Univ. |
| Organization code | ||
| Developer | Hiroko Oshima | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Wnt5a |
| Gene name | wingless-related MMTV integration site 5A |
| Allele symbol | |
| Allele name | |
| MGI | MGI:98958, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM | OMIM ID: 164975 Human Gene Symbol: WNT5A, |
| Gene symbol | Ptgs2 |
| Gene name | prostaglandin-endoperoxide synthase 2; |
| Allele symbol | |
| Allele name | |
| MGI | MGI:97798, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM | OMIM ID: 600262 Human Gene Symbol: PTGS2, |
| Gene symbol | Ptges |
| Gene name | prostaglandin E synthase |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1927593, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM | OMIM ID: 605172 Human Gene Symbol: PTGES, |
| Wnt5a-F | AGCAGGCCGTAGGACAGTAT |
| HA-R | CATCATATGGGTAGGCCATGG |
| Disease name, Applicable field | Development, cancer |