| CARD ID | 777 | |
| Type of strain | Transgenic. | |
| Strain name | B6;C3H-Tg(TRE-Ptgs2) | |
| Internal Code | TRE-COX-2 | |
| Submitter | Masanobu Oshima | |
| Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Cancer Research Institute, Kanazawa Univ. |
| Organization code | ||
| Developer | Hiroko Oshima | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ptgs2 (synonym: COX-2) |
| Gene name | prostaglandin-endoperoxide synthase 2 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:97798, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| GO | Gene Ontology |
| OMIM | OMIM ID: 600262 Human Gene Symbol: PTGS2, |
| COX-2-F3 | CAAACTCAAGTTTGACCCAG |
| COX-2-R1 | CTTTTACAGCTCAGTTGAACG |
| Disease name, Applicable field | Physiology, cancer, Metabolism |