| CARD ID | 775 | |
| Type of strain | Transgenic. | |
| Strain name | B6;C3H-Tg(K19-Ptgs2/K19-Ptges) | |
| Internal Code | K19-C2mE | |
| Submitter | Masanobu Oshima | |
| Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Cancer Research Institute, Kanazawa Univ. |
| Organization code | none | |
| Developer | Hiroko Oshima | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ptgs2 |
| Gene name | prostaglandin-endoperoxide systhase 2 (Ptgs2) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:97798, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM | OMIM ID: 600262 Human Gene Symbol: PTGS2, |
| Gene symbol | Ptges |
| Gene name | prostaglandin E synthase (Ptges) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1927593, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| GO | Gene Ontology |
| OMIM | OMIM ID: 605172 Human Gene Symbol: PTGES, |
| COX-2-F3 | CAAACTCAAGTTTGACCCAG |
| COX-2-R1 | CTTTTACAGCTCAGTTGAACG |
| Author | Hiroko Oshima, Masanobu Oshima, Kayo Inaba and Makoto M Taketo |
| Title | Hyperplastic gastric tumors induced by activated macrophages in COX-2/mPGES-1 transgenic mice |
| Journal | The EMBO Journal |
| Volume | 23 |
| Page | 1669-1678 |
| Year | 2004 |
| PMID |
| Disease name, Applicable field | cancer |