| CARD ID | 762 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-B4galt6tm1 | |
| Internal Code | none | |
| Submitter | Koichi Furukawa | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Nagoya Univ. Sch. of Med. |
| Organization code | ||
| Developer | Koichi Furukawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | B4galt6 |
| Gene name | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 |
| Allele symbol | B4galt6tm1 |
| Allele name | targeted mutation 1 |
| MGI | MGI:1928380, |
| Chromosome | 18 (q12) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM | OMIM ID: 604017 Human Gene Symbol: B4GALT6, |
| Se1 | GCCTGCTTGCCGAATATCATGGTGGAAAAT |
| T6K031 | CCCTCTGCAAGAACAAGAGTTTCACCTCA |
| Disease name, Applicable field | Unknown |