| CARD ID | 756 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6Slc-Tg(CAG-Per2)MX07-3CCB | |
| Internal Code | MX07-3 | |
| Submitter | Koyomi Miyazaki | |
| Submitter affiliation or code | AIST, Institute of Biological Resource and Function, Clock Cell Biology | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Japan SLC |
| Organization code | Slc | |
| Developer | ||
| Year introduced | 2001 / 10 | |
| Introduced Generation | F | |
| Remarks | ||
| Gene symbol | Per2 |
| Gene name | period homolog 2 (Drosophila) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1195265, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection C57BL/6Slc |
| OMIM | OMIM ID: 603426 Human Gene Symbol: PER2, |
| rPer2-MX5-F1 | ACTCAGGCTATGAAGCTCCTAGA |
| rPer2-MX5-R1 | GTGCAGAGGGACAGCTAGAC |
| Disease name, Applicable field | Physiology, Metabolism |