| CARD ID | 738 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(B19p6-NS1w)12Tusm | |
| Internal Code | C57BL/6-Tg(B19p6NS1w)12Tusm, N12 | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Tohoku University |
| Organization code | Tusm | |
| Developer | Naruhiko Takasawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | NS1 |
| Gene name | human parvovirus B19 NS1 |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Im-1 | CGCCTGGAACACTGAAACCC |
| Im-2 | AGCCTGCACCTGAGGAGTGA |
| Author | Naruhiko Takasawa, Yasuhiko Munakata, Keiko Kumura Ishii, Yuichi Takahashi, Minako Takahashi, Yi Fu, Tomonori Ishii, Hiroshi Fujii, Takako Saito, Hiroshi Takano, Tetsuo Noda, Misao Suzuki, Masato Nose, Suzan Zolla-Patzner, and Takeshi Sasaki |
| Title | Human Parvovirus B19 Transgenic Mice Become Susceptible to Polyarthritis |
| Journal | The Journal of Immunology |
| Volume | 173 |
| Page | 4675-4683 |
| Year | 2004 |
| PMID |
| Disease name, Applicable field | Immunology |