| CARD ID | 709 | |
| Type of strain | Transgenic. | |
| Strain name | B6;C3H-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges) | |
| Internal Code | B6;C3H-Tg(K19-wnt1/k19-Ptgs2/k19-Ptges), K19-Wnt1/C2mE | |
| Submitter | Masanobu Oshima | |
| Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Cancer Research Institute, Kanazawa Univ. |
| Organization code | ||
| Developer | Hiroko Oshima | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Wnt1, Ptgs2, Ptges |
| Gene name | Wnt1:wingless-related MMTV integration site 1), |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM | OMIM ID: 164820 Human Gene Symbol: WNT1, OMIM ID: 600262 Human Gene Symbol: PTGS2, OMIM ID: 605172 Human Gene Symbol: PTGES, |
| Wnt1F,COX-2-F3 | CGACCGTGTTCTCTGAGATG,CAAACTCAAGTTTGACCCAG |
| HA-R,COX-2-R1 | CATCATATGGGTAGGCCATGG,CTTTTACAGCTCAGTTGAACG |
| Author | Oshima H, Matsunaga A, Fujimura T, Tsukamoto T, Taketo MM, Oshima M. |
| Title | Carcinogenesis in mouse stomach by simultaneous activation of the wnt signaling and prostaglandin e(2) pathway. |
| Journal | Gastroenterology |
| Volume | 131 |
| Page | 1086-1095 |
| Year | 2006 |
| PMID |
| Disease name, Applicable field | cancer |