| CARD ID | 688 | |
| Type of strain | Gene trap. | |
| Strain name | C57BL/6J-Asp4Gt(Ayu22)74Imeg | |
| Internal Code | Ayu22-74 | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Institute of Molecular Embryology and Genetics Kumamoto University |
| Organization code | Imeg | |
| Developer | Kimi Araki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Asp4 |
| Gene name | adipocyte-specific protein 4 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1914413, |
| Chromosome | 11 (106,015,000-106,033,000) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM |
| Neo-F | AGAGGCTATTCGGCTATGAC |
| Neo-R | CACCATGATATTCGGCAAGC |
| Author | |
| Title | |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field | Development |
| EGTC番号 | 22-74 |