| CARD ID | 655 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129Sv-Avpr1btml | |
| Internal Code | V1b KO | |
| Submitter | Nakamura Kazuaki | |
| Submitter affiliation or code | National Research Institute for Child Health and Development | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | National Center for Child Health and Development Research Institute Dept | |
| Developer | Tanoue Akito | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Avpr1b |
| Gene name | arginine vasopressin receptor 1B |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1347010, |
| Chromosome | 1 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM |
| V<sub>1</sub>b KO sense | ACTTCTTACTTGCACCCACACCGTC |
| V<sub>1</sub>b KO AS | AAATGGCCGCTTTTCTGGATTCATC |
| Author | Akito Tanoue, Shuji Ito, Kenji Honda, Sayuri Oshikawa, Yoko Kitagawa, Taka-aki Koshimizu, Toyoki Mori, and Gozoh Tsujimoto |
| Title | The vasopressin V1b receptor critically regulates hypothalamic-pituitary-adrenal axis activity under both stress and resting conditions |
| Journal | The Journal of Clinical Investigation |
| Volume | 113 |
| Page | 302-309 |
| Year | 2004 |
| PMID |
| Disease name, Applicable field | Physiology |