| CARD ID | 608 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-G5prtm1LrsnImku | |
| Internal Code | G5pr-flox, B6;CB-G5prtm1LrsnImku | |
| Submitter | Nobuo SAKAGUCHI | |
| Submitter affiliation or code | Kumamoto University School of Medicine, Department of Immunoloy | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Immunology, Kumamoto University |
| Organization code | Imuk | |
| Developer | Nobuo Sakaguchi | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | AJ238247 (Genebank accession #) |
| Gene name | g5Pr |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| G1 | GAGGGGCCATGGAAATGCAGCATAAACA |
| G2 | TCGCAGCTCACCAAGCCGGATTTCTAAAGG |
| Author | Yan Xing, Hideya Igarashi, Xiaodan Wang, and Nobuo Sakaguchi |
| Title | Protein phosphatase subunit G5PR is needed for inhibition of B cell receptor-induced apoptosis |
| Journal | The Journal of Experimental Medicine |
| Volume | 202 |
| Page | 707-719 |
| Year | 2005 |
| PMID | 16129705 |
| Disease name, Applicable field | Immunology |