CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - 日本語

CARD Mouse Bank

Mouse strain

Strain information

CARD ID		513
Type of strain		Targeted mutant.
Strain name		B6;129-Six1^{tm1(Sall1)#136Imeg}
Internal Code		Six1Sall1-136
Submitter		Nishinakamura Ryuichi
Submitter affiliation or code		Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University
Stock Type
Material Transfer Conditions		Consent to us
Production method		in-house breeding
Origin (In-house)	Organization	IMEG, Div. of IntegrativeCell Biology
	Organization code	Imeg
	Developer	Ryuichi Nishinakamura
Origin (From other organizations)	Organization
	Organization code
	Developer
	Year introduced
	Introduced Generation
Remarks

Gene information

Gene symbol	Six1
Gene name	B6;129-Six1^tm1#123
Allele symbol
Allele name
MGI	MGI:102780,
Chromosome	12 (31.0) ,
Gene classification	Targeted or trapped gene(knockout etc.)
Method	Electroporation
OMIM

PCR Primer 1
Six1Sall1(Neo-); mixture of 25 micro M each	ccatatgctggctgccatgaac cacctccagtttggtggacttgg and ttggagaggagggagaggatgc

Disease , Applicable field information

Disease name, Applicable field

Copyright @ 2021 Kumamoto University. All rights reserved.