| CARD ID | 503 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Sall1tm1(Cre) | |
| Internal Code | Sall CreER-127 | |
| Submitter | Nishinakamura Ryuichi | |
| Submitter affiliation or code | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
It is necessary to quote the following article. Inoue S, Inoue M, Fujimura S, and Nishinakamura R. A mouse line expressing Sall1-driven inducible Cre recombinase in the kidney mesenchyme. Genesis 48: 207-212, 2010. GIE-CERBM (IGBMC) has designed the Cre-ERT2 construct and has been granted an US patent (No7112715) and an European patent (NoIB01/02246) that cover the use of Cre-ERT2 transgenic mice. Kumamoto University may transfer MATERIAL, MODIFICATIONS, and/or derived Cre-ERT2-containing transgenic mice to other scientists at non-profit institutions ("Collaborator") for non-industrially sponsored research, non-commercial, internal, and academic research if, and only if, Collaborator has obtained a Cre-ERT2 MTA from IGBMC (please contact chambon@igbmc.fr to obtain a copy of the MTA). |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University |
| Organization code | ||
| Developer | Ryuichi Nishinakamura, Miki Inoue | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sall1 |
| Gene name | sal-like 1 (Drosophila) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1889585, |
| Chromosome | 8 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM |
| Sall1C (msal64, 65,Neo); mixture of 25 micro M each | AGCTAAAGCTGCCAGAGTGC, CAACTTGCGATTGCCATAAA and GCGTTGGCTACCCGTGATAT |
| |
| Author | Inoue S, Inoue M, Fujimura S, and Nishinakamura |
| Title | A mouse line expressing Sall1-driven inducible Cre recombinase in the kidney mesenchyme. |
| Journal | Genesis |
| Volume | 48 |
| Page | 207-212 |
| Year | 2010 |
| PMID |
| Disease name, Applicable field | Development |