| CARD ID | 499 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Sall4tm3 | |
| Internal Code | Sall4 b-geo #2 | |
| Submitter | Nishinakamura Ryuichi | |
| Submitter affiliation or code | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Univ. of Tokyo. Inst. of Med. Sci. Div. of Stem cell regulation |
| Organization code | ||
| Developer | Masayo Yumoto | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sall4 |
| Gene name | sal-like4 (Drosophila) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:2139360, |
| Chromosome | 2 (99.0) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Sall4 b-geo genome check (Sall4-15, 16, Neo F, Neo R); mixture of 25 micro M each | GAGGACTCCATACCGGTGAA, GTGCCCAGCTTCTTCAAGTC, AAGGGACTGGCTGCTATTGG and ATATCACGGGTAGCCAACGC |
| |
| Author | |
| Title | |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field |