| CARD ID | 480 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-Mcl1tm1 | |
| Internal Code | EAT.#74 flox, B6;CB-Mcl1tm1 | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | ||
| Origin (In-house) | Organization | National Research Institute for Child Health and Development |
| Organization code | ||
| Developer | Hajime Okita | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mcl1 |
| Gene name | myeloid cell leukemia sequence 1 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:101769, |
| Chromosome | 3 (43.6cM) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM | OMIM ID: 159552 Human Gene Symbol: MCL1, |
| mEAT011 | CGACCGGCTCCAAGGACTCGAAG |
| mEAT007 | ATAAGAGTCACAATCCTGCCCCA |
| Author | |
| Title | |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field | Unknown |