| CARD ID | 466 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Dullardtm1Imeg | |
| Internal Code | - | |
| Submitter | Nishinakamura Ryuichi | |
| Submitter affiliation or code | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Division of Intergrative Cell Biology, IMEG, Kumamoto University |
| Organization code | ||
| Developer | Ryuichi Nishinakamura | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Dullard |
| Gene name | Dullard homolog (Xenopus laevis) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1914431, |
| Chromosome | 11 (B4 band) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Du15783s, Du16012as ; mixture of 25 micro M each | GTTCTTGGGACACCGTCTGT, AGTCCTGCCTCTTCACCAGA |
| neo β c KO, Du-2 ; mixture of 25 micro M each | "GCGTTGGCTACCCGTGATAT, TTACAGGTATGGGGGATTGG" |
| Author | |
| Title | |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Author | Tanaka SS, Nakane A, Yamaguchi YL, Terebayashi T, Abe T, Nakao K, Asashima M, Steiner KA, Tam PP, and Nishinakamura R |
| Title | Dullard/Ctdnep1 modulates WNT signaling activity for the formation of primordial germ cells in the mouse embryo. |
| Journal | PLoS One |
| Volume | 8(3) |
| Page | e57428 |
| Year | 2013 |
| PMID |
| Disease name, Applicable field | Development |