| CARD ID | 465 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Sall4tm2 | |
| Internal Code | Sall4 KO | |
| Submitter | Nishinakamura Ryuichi | |
| Submitter affiliation or code | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | ||
| Origin (In-house) | Organization | Univ. of Tokyo, Inst. of Med. Sci., Div. of Stem Cell Regulation |
| Organization code | ||
| Developer | Masayo Yumoto | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sall4(NM175303) |
| Gene name | sal-like 4 (Drosophila) |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | 2 (99cM) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Sall4 genome check (msal4-15, 16, lacZ) ; mixture of 25 micro M each | GAGGACTCCATACCGGTGAA, GTGCCCAGCTTCTTCAAGTC and CCTCTTCGCTATTACGCCAG |
| Author | |
| Title | |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field | Development |