| CARD ID | 441 | |
| Type of strain | Gene trap. | |
| Strain name | B6;CB-Slc7a2Gt(pU-21)128Imeg | |
| Internal Code | Ayu21-128 | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Institute of Molecular Embryology and Genetics Kumamoto University |
| Organization code | Imeg | |
| Developer | Kimi Araki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Slc7a2 |
| Gene name | solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
| Allele symbol | Slc7a2Gt(Ayu21)128Imeg |
| Allele name | targeted mutation 128, Institute of molecular embryology and genetics |
| MGI | MGI:99828, |
| Chromosome | 8 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM | OMIM ID: 601872 Human Gene Symbol: SLC7A2, |
| Z-1 | GCGTTACCCAACTTAATCG |
| Z-2 | TGTGAGCGAGTAACAACCCG |
| Author | |
| Title | |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field | Development |
| EGTC番号 | 21-128 |