| CARD ID | 379 | |
| Type of strain | Targeted mutant. | |
| Strain name | STS.B6CB-Trp53tm1Sia | |
| Internal Code | STS/A-p53+/KO, STS.B6CB-Trp53tm1Sia | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Shiro Aizawa |
| Organization code | ||
| Developer | National Institute of Radiological Sciences | |
| Year introduced | 2001 / 9 | |
| Introduced Generation | N17 | |
| Remarks | ||
| Gene symbol | Trp53 |
| Gene name | Transformation related protein 53 |
| Allele symbol | Trp53tm1Sia |
| Allele name | Trp53, targeted mutation 1, Shinichi Aizawa |
| MGI | MGI:98834, |
| Chromosome | 11 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| GO | Gene Ontology |
| OMIM | OMIM ID: 191170 Human Gene Symbol: TP53, |
| primerA | 5'(aattgacaagttatgcatccatacagtaaca)3' |
| primerB | 5'(actcctcaacatcctggggcagcaacagat)3' |
| Author | M Okumoto, R Nishikawa, S Imai and J Hilgers |
| Title | Genetic analysis of resistance to radiation lymphomagenesis with recombinant inbred strains of mice |
| Journal | Cancer Research |
| Volume | 50 |
| Page | 3848-3850 |
| Year | 1990 |
| PMID | 2354437 |
| Author | Okumoto M, Nishikawa R, Imai S, Hilgers J. |
| Title | Resistance of STS/A mice to lymphoma induction by X-irradiation. |
| Journal | J Radiat Res (Tokyo) |
| Volume | 30 |
| Page | 135-139 |
| Year | 1989 |
| PMID | 2769623 |
| Disease name, Applicable field | cancer |