| CARD ID | 3591 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Spint2tm1.1Hk/16 | |
| Internal Code | Spint-2 floxed mouse #16 | |
| Submitter | Yuichiro Sato | |
| Submitter affiliation or code | Section of Oncopathology and Morphological Pathology, Department of Pathology, Faculty of Medicine, University of Miyazaki | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | University of Miyazaki |
| Organization code | ||
| Developer | Hiroaki Kataoka | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Spint2 |
| Gene name | serine protease inhibitor, Kunitz type 2 |
| Allele symbol | Spint2tm1.1Hk |
| Allele name | serine protease inhibitor, Kunitz type 2; targeted mutation 1.1, Hiroaki Kataoka |
| MGI | MGI:1338031, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Spint2LongF1 | GATGGCAAATGTGTCCAACTAGAAT |
| Spint2ExonR1 | CTCAAATCCAAGAACTTCAGAGAC |
| Author | Makiko Kawaguchi, Koji Yamamoto, Naoki Takeda, Tsuyoshi Fukushima, Fumiki Yamashita, Katsuaki Sato, Kenichiro Kitamura, Yoshitaka Hippo, James W. Janetka, Hiroaki Kataoka |
| Title | Hepatocyte growth factor activator inhibitor-2 stabilizes Epcam and maintains epithelial organization in the mouse intestine |
| Journal | Communications Biology volume |
| Volume | 2 |
| Page | |
| Year | 2019 |
| PMID | 30623107 |
| Disease name, Applicable field | Digestive Disorders, Neurobiology, cancer, infectious, Molecular biology, Anatomy, Physiology |