CARD R-BASE



Mouse strain


Strain information

CARD ID 3518
Type of strain Targeted mutant.
Strain name B6D2-Galntl5em4 Kms
Internal Code B6D2-Galntl5 em4
Submitter Taichi Noda
Submitter affiliation or code Division of Reproductive Biology, IRDA, Kumamoto University
Stock Type
Material Transfer Conditions Others
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Galntl5
Gene name UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Allele symbol Galntl5em4 Kms
Allele name UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5; endonuclease-mediated mutation 4, Division of Reproductive Biology, Institute of Resource Development and Analysis, Kumamoto University
MGI MGI:1915159,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Primer1 (for WT and KO allele) TGCTCAAGGGGTAAGGCAAG
Primer2 (for WT and KO allele) CTCTGAGTGACGGGTTTGCT


References

Author Taichi Noda, Reika Uriu, Daisuke Mashiko, Hina Shinohara, Yongcun Qu, Ayumu Taira, Ryan M. Matzuk, Duri Tahala, Motochika Nakano, Kimi Araki, Zhifeng Yu, Ying Zhang, Martin M. Matzuk, and Masahito Ikawa
Title GALNTL5 binds GalNAc and is required for migration through the uterotubal junction and sperm-zona pellucida binding
Journal Nature Communications
Volume 16
Page 8264 DOI:10.1038/s41467-025-63805-4
Year 2025
PMID 40962834


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.