| CARD ID | 3517 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Galntl5em3 Kms | |
| Internal Code | B6D2-Galntl5 em3 | |
| Submitter | Taichi Noda | |
| Submitter affiliation or code | Division of Reproductive Biology, IRDA, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Galntl5 |
| Gene name | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 |
| Allele symbol | Galntl5em3 Kms |
| Allele name | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5; endonuclease-mediated mutation 3, Division of Reproductive Biology, Institute of Resource Development and Analysis, Kumamoto University |
| MGI | MGI:1915159, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Primer1 (for WT and KO allele) | TGCTCAAGGGGTAAGGCAAG |
| Primer2 (for WT and KO allele) | CTCTGAGTGACGGGTTTGCT |
| Primer3 (for WT allele) | CACTTTTCATTGTGGGTTTC |
| Author | Taichi Noda, Reika Uriu, Daisuke Mashiko, Hina Shinohara, Yongcun Qu, Ayumu Taira, Ryan M. Matzuk, Duri Tahala, Motochika Nakano, Kimi Araki, Zhifeng Yu, Ying Zhang, Martin M. Matzuk, and Masahito Ikawa |
| Title | GALNTL5 binds GalNAc and is required for migration through the uterotubal junction and sperm-zona pellucida binding |
| Journal | Nature Communications |
| Volume | 16 |
| Page | 8264 DOI:10.1038/s41467-025-63805-4 |
| Year | 2025 |
| PMID | 40962834 |
| Disease name, Applicable field |