| CARD ID | 359 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Adra1dtm1 | |
| Internal Code | B6 α1D-AR-KO | |
| Submitter | Nakamura Kazuaki | |
| Submitter affiliation or code | National Research Institute for Child Health and Development | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | Tanoue Akito | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Adra1d |
| Gene name | Adrenergic recetor, alpha 1d |
| Allele symbol | Adra1dtm1 |
| Allele name | Adrenergic recetor, alpha 1d, targeted mutation 1 |
| MGI | MGI:106673, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM | OMIM ID: 104219 Human Gene Symbol: ADRA1D, |
| primerA | 5'(ACACAGCTGCACTCAGTAGCAGGTCA)3' |
| primerB | 5'(CCTAC,ATTTT,GAATG,GAAGG,ATTG)3' |
| Author | Akito Tanoue, Yoshihisa Nasa, Takaaki Koshimizu, Hitomi Shinoura, Sayuri Oshikawa, Takayuki Kawai, Sachie Sunada, Satoshi Takeo, and Gozoh Tsujimoto |
| Title | The α1D-adrenergic receptor directly regulates arterial blood pressure via vasoconstriction |
| Journal | The Journal of Clinical Investigation |
| Volume | 109 |
| Page | 765-775 |
| Year | 2002 |
| PMID | 11901185 |
| Disease name, Applicable field | Physiology |