CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 359
Type of strain Targeted mutant.
Strain name B6;129-Adra1dtm1
Internal Code B6 α1D-AR-KO
Submitter Unknown Unknown
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer Tanoue Akito
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Adra1d
Gene name Adrenergic recetor, alpha 1d
Allele symbol Adra1dtm1
Allele name Adrenergic recetor, alpha 1d, targeted mutation 1
MGI MGI:106673,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
GO Gene Ontology
OMIM OMIM ID: 104219 Human Gene Symbol: ADRA1D,

PCR Primer 1
primerA 5'(ACACAGCTGCACTCAGTAGCAGGTCA)3'
primerB 5'(CCTAC,ATTTT,GAATG,GAAGG,ATTG)3'


References

Author Akito Tanoue, Yoshihisa Nasa, Takaaki Koshimizu, Hitomi Shinoura, Sayuri Oshikawa, Takayuki Kawai, Sachie Sunada, Satoshi Takeo, and Gozoh Tsujimoto
Title The α1D-adrenergic receptor directly regulates arterial blood pressure via vasoconstriction
Journal The Journal of Clinical Investigation
Volume 109
Page 765-775
Year 2002
PMID 11901185


Disease , Applicable field information

Disease name, Applicable field Physiology






Copyright @ 2021 Kumamoto University. All rights reserved.