| CARD ID | 3432 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Hsf5em1(Hsf5-3xFLAG-HA) | |
| Internal Code | Hsf5-3FH #3 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hsf5 |
| Gene name | heat shock transcription factor family member 5 |
| Allele symbol | Hsf5em1(Hsf5-3xFLAG-HA) |
| Allele name | heat shock transcription factor family member 5; endonuclease-mediated mutation 1, |
| MGI | MGI:2685585, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Hsf 5-3xFLAG-HA_genotyping_3F | TGAAGGCATGTCTGTTGACGTC |
| Hsf 5-3xFLAG-HA_genotyping_1R | GCATCACGACTCAGCACACA |
| Disease name, Applicable field | Reproduction, Cell biology |