| CARD ID | 3392 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Gpr84 em1 | |
| Internal Code | GPR84-floxed | |
| Submitter | Kimura Ikuo | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gpr84 |
| Gene name | G protein-coupled receptor 84 |
| Allele symbol | Gpr84em1 |
| Allele name | G protein-coupled receptor 84; endonuclease-mediated mutation 1, |
| MGI | MGI:1934129, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Primer1 | CTGGGAAGTAATTAGGATGGAAGC |
| Primer2 | CTTTAATTCTTGGCTGGAAAGCAC |
| Disease name, Applicable field | Unknown |