| CARD ID | 3391 | |
| Type of strain | Targeted mutant. | |
| Strain name | NSY.B6-Tyr+,Ay-Glp1rem2Nmea | |
| Internal Code | NSY-Ay-Glp1r・KO | |
| Submitter | Tamio Ohno | |
| Submitter affiliation or code | Division of Experimental Animals, Graduate School of Medicine, Nagoya University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Nmea | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Glp1r |
| Gene name | glucagon like peptide 1 receptor |
| Allele symbol | Glp1rem2Nmea |
| Allele name | Glucagon-like peptide 1; endonuclease-mediated mutation 2, Division of Experimental Animals, Graduate School of Medicine, Nagoya University |
| MGI | MGI:99571, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Glp1r_Int3F2 | GTGCATGCGATTCCTGTTACTAAC |
| Glp1r_Int5R3 | TGCATGCTGGAGTTAACAAGCTTC |
| Disease name, Applicable field | Metabolism, Diabetes, Obesity |