| CARD ID | 3380 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Or51e1em1 | |
| Internal Code | Gpr164KO | |
| Submitter | Kimura Ikuo | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Or51e1 |
| Gene name | olfactory receptor family 51 subfamily E member 1 |
| Allele symbol | Or51e1em1 |
| Allele name | olfactory receptor family 51 subfamily E member 1; endonuclease-mediated mutation 1, |
| MGI | MGI:3030392, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| GPR164_F1 | AGGGTTCAGGATAAAATTACAGTCA |
| GPR164_R1 | CCAATTCTAACTTCTCAGAAATCCA |
| Disease name, Applicable field | Unknown |