| CARD ID | 3306 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Sordem110-4 | |
| Internal Code | Sord flox #10-4 | |
| Submitter | Masayasu Kojima | |
| Submitter affiliation or code | Kurume University Institute of Life Science | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sord |
| Gene name | Sorbitol dehydrogenase |
| Allele symbol | Sordem110-4 |
| Allele name | sorbitol dehydrogenase; endonuclease-mediated mutation 1, |
| MGI | MGI:98266, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 5loxP_F2 | taaccctggccagttaacca |
| 5loxP_R2 | aggagctcattgggaacaca |
| 3loxP_F2 | aatcactgagtgcccagagtc |
| 3loxP_R2 | gccctaccatgaaaaagtcg |
| Disease name, Applicable field | Metabolism, Endocrine Disorders |