| CARD ID | 3295 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Aldoart2em1Kms Aldoart2em2Kms | |
| Internal Code | B6D2-Aldoart2 |
|
| Submitter | Taichi Noda | |
| Submitter affiliation or code | Division of Reproductive Biology, IRDA, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Div. of Reproductive Biology, IRDA, Kumamoto university |
| Organization code | ||
| Developer | Taichi Noda | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Aldoart2 |
| Gene name | aldolase 1 A, retrogene 2 |
| Allele symbol | Aldoart2em2Kms |
| Allele name | aldolase 1 A, retrogene 2; endonuclease-mediated mutation 2, Division of Reproductive Biology, Institute of Resource Development and Analysis, Kumamoto University |
| MGI | MGI:1931052, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Gene symbol | Aldoart2 |
| Gene name | aldolase 1 A, retrogene 2 |
| Allele symbol | Aldoart2em1Kms |
| Allele name | aldolase 1 A, retrogene 2; endonuclease-mediated mutation 1, Division of Reproductive Biology, Institute of Resource Development and Analysis, Kumamoto University |
| MGI | MGI:1931052, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Primer 1 | CGTCCTCTGAGTAGGTTGCG |
| Primer 2 | CTGTCTACAAGGCTCTGAGC |
| Primer 3 | ACATGGGATGGCTGGAGTGG |
| Author | Taichi Noda 1 2 , Ayumu Taira 1 3 , Hina Shinohara 1 3 , Kimi Araki 3 |
| Title | The testis-, epididymis-, or seminal vesicle-enriched genes Aldoart2, Serpina16, Aoc1l3, and Pate14 are not essential for male fertility in mice |
| Journal | Exp Anim. |
| Volume | |
| Page | |
| Year | 2023 |
| PMID | 36709994 |
| Disease name, Applicable field |