| CARD ID | 3286 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Il1rl2em1 | |
| Internal Code | IL36R-KO | |
| Submitter | Mitsuyoshi Takiguchi | |
| Submitter affiliation or code | Faculty of Veterinary Medicine, Hokkaido University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Il1rl2 |
| Gene name | interleukin 1 receptor-like 2 |
| Allele symbol | Il1rl2em1 |
| Allele name | interleukin 1 receptor-like 2; endonuclease-mediated mutation 1, |
| MGI | MGI:1913107, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| mIl1rl2-KO-ex-F1 | GCATCCTTTGTCATTCATCTCCG |
| mIl1rl2-KO-ex-R1 | CGGAAATGGCAGCAATCTCATT |
| Disease name, Applicable field |