| CARD ID | 3283 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(Myb-74-mhsp68-EGFP) | |
| Internal Code | Myb -74 GFP | |
| Submitter | Toshio SUDA | |
| Submitter affiliation or code | International Research Center for Medical Sciences, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | CSI Singapore, National University of Singapore |
| Organization code | ||
| Developer | Toshio Suda | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | EGFP |
| Gene name | エンハンストGFP |
| Allele symbol | |
| Allele name | |
| MGI | MGI:, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Primer1 | aagttcatctgcaccaccg |
| Primer2 | tccttgaagaagatggtgcg |
| Primer3 | TGTCAGCATTCCAACAAGCC |
| Primer4 | AGGAACTAGAGGCTCTGTCC |
| Author | Takayoshi Matsumura, Haruhito Totani, Yoshitaka Gunji , Masahiro Fukuda , Rui Yokomori , Jianwen Deng , Malini Rethnam, Chong Yang , Tze King Tan , Tadayoshi Karasawa, Kazuomi Kario, Masafumi Takahashi, Motomi Osato, Takaomi Sanda, Toshio Suda |
| Title | A Myb enhancer-guided analysis of basophil and mast cell differentiation |
| Journal | Nat Commun |
| Volume | 13(1) |
| Page | 7064 |
| Year | 2022 |
| PMID | PMC9674656 " target="_blank" >PMC9674656 |
| Disease name, Applicable field | cancer, Immunology, Cell biology, Laboratory-animal Science, Development, Molecular biology |