| CARD ID | 3265 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Gt(ROSA)26Sortm2(CAG-Evi1) | |
| Internal Code | ROSA-CAG-Evi1 | |
| Submitter | Tomomasa Yokomizo | |
| Submitter affiliation or code | Tokyo Women’s Medical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gt(ROSA)26Sor |
| Gene name | gene trap ROSA 26, Philippe Soriano |
| Allele symbol | Gt(ROSA)26Sortm2(CAG-Evi1) |
| Allele name | |
| MGI | MGI:, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Evi1seq1152_Fw | ctgaggagagggaatacaagtgtg |
| Evi1seq1413_Rv | acactgctgtggatgtgcttg |
| Disease name, Applicable field | peromelia, cancer, Immunology, Development |