| CARD ID | 3242 | |
| Type of strain | Transgenic., Targeted mutant. | |
| Strain name | C57BL/6-Cdk5rap1tm1 | |
| Internal Code | Cdk5rap1-f/f | |
| Submitter | Kazuhito Tomizawa | |
| Submitter affiliation or code | Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cdk5rap1 |
| Gene name | Cdk5rap1 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| Gene symbol | Cdk5rap1 |
| Gene name | CDK5 regulatory subunit associated protein 1 |
| Allele symbol | Cdk5rap1tm1 |
| Allele name | CDK5 regulatory subunit associated protein 1; targeted mutation 1, |
| MGI | MGI:1914221, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Cdk5rap1_WT_forward | ATGTGAACAGTATACATGGATGTA |
| Cdk5rap1_WT_reverse | CAAGACTATGCCATTAGGAGTCAGA |
| Disease name, Applicable field |