| CARD ID | 3228 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Ror1tm1 | |
| Internal Code | Ror1f/f | |
| Submitter | Takashi Takahashi | |
| Submitter affiliation or code | Aichi Cancer Center | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | UNITEC |
| Organization code | 不明 | |
| Developer | ||
| Year introduced | 2013 / 3 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ror1 |
| Gene name | receptor tyrosine kinase-like orphan receptor 1 |
| Allele symbol | Ror1tm1 |
| Allele name | receptor tyrosine kinase-like orphan receptor 1; targeted mutation 1, |
| MGI | MGI:1347520, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Ror1 flox-F | ATGATAGAACGCTGGCTTTGAGAC |
| Ror1 flox-R | CTAACTTCTAGGGGACTCTCAATCC |
| Author | Isomura H, Taguchi A, Kajino T, Asai N, Nakatochi M, Kato S, Suzuki K,Yanagisawa K, Suzuki M, Fujishita T, Yamaguchi T, Takahashi M, Takahashi T. |
| Title | Conditional Ror1 knockout reveals crucial involvement in lung adenocarcinomadevelopment and identifies novel HIF-1α regulator. |
| Journal | Cancer Sci. |
| Volume | 112 |
| Page | 1614 |
| Year | 2021 |
| PMID | 33506575 |
| Disease name, Applicable field | Metabolism, Neurobiology, Dermatology, cancer, Immunology, Development, Anatomy, Physiology |