| CARD ID | 3227 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(SPC-EGFRdelta746-750)Takt | |
| Internal Code | SPC-hEGFRdel746-750 | |
| Submitter | Takashi Takahashi | |
| Submitter affiliation or code | Aichi Cancer Center | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Kenichi Yamamura |
| Organization code | 不明 | |
| Developer | Center for Animal Resources and Development, Kumamoto University | |
| Year introduced | 2013 / 7 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | EGFR |
| Gene name | epidermal growth factor receptor |
| Allele symbol | |
| Allele name | |
| MGI | MGI:, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| EGFRΔ746-750-F | GCCAGGAACAAACAGGCTTC |
| EGFRΔ746-750-R | CCAAAGGAATTCGCTCCACT |
| Author | Isomura H, Taguchi A, Kajino T, Asai N, Nakatochi M, Kato S, Suzuki K,Yanagisawa K, Suzuki M, Fujishita T, Yamaguchi T, Takahashi M, Takahashi T. |
| Title | Conditional Ror1 knockout reveals crucial involvement in lung adenocarcinomadevelopment and identifies novel HIF-1α regulator. |
| Journal | Cancer Sci. |
| Volume | 112 |
| Page | 1614 |
| Year | 2021 |
| PMID | 33506575 |
| Disease name, Applicable field | Metabolism, cancer, Immunology |