CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3175
Type of strain Targeted mutant.
Strain name C57BL/6-4930599N23Rikem1
Internal Code 4930599N23Rik
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol 4930599N23Rik
Gene name RIKEN cDNA 4930599N23 gene
Allele symbol 4930599N23Rikem1
Allele name RIKEN cDNA 4930599N23 gene; endonuclease-mediated mutation 1,
MGI MGI:1922629,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
4930599N23Rik-F2 CTACTGGTACCCCCTAGCCCACATC
4930599N23Rik-R1 CACTCTTGGAGCTGAGAAACAGAAA
PCR Primer 2
4930599N23Rik-F1 CGCCTTCTTGACGAGTTCTTCTGAG
4930599N23Rik-R1 CACTCTTGGAGCTGAGAAACAGAAA


Disease , Applicable field information

Disease name, Applicable field Reproduction, Cell biology






Copyright @ 2021 Kumamoto University. All rights reserved.