CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3173
Type of strain Targeted mutant.
Strain name C57BL/6J-Rnf123em1Nmea
Internal Code NC-Rnf123・KO #2
Submitter Tamio Ohno
Submitter affiliation or code Division of Experimental Animals, Graduate School of Medicine, Nagoya University
Stock Type
Material Transfer Conditions Others
Production method in-house breeding
Origin (In-house) Organization Division of Experimental Animals, Graduate School of Medicine, Nagoya University
Organization code Nmea
Developer Yuki Miyasaka・Tamio Ohno
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Rnf123
Gene name Ring Finger Protein 123
Allele symbol Rnf123em1Nmea
Allele name Ring Finger Protein 123; endonuclease-mediated mutaion 1, Division of Experimental Animals, Graduate School of Medicine, Nagoya University
MGI MGI:2148796,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
Rnf123_Int2F AACATGGGATTTTCCATACCCCTTG
Rnf123_Int3R GAGAGGATTGGAGCTACACACACAAC


References

Author Yuki Miyasaka, Shota Niwa, Tomomi Masuya, Reika Ishii, Misato Kobayashi, Fumihiko Horio and Tamio Ohno
Title E3 ubiquitin ligase RNF123-deficient mice exhibit reduced parasitemia and mortality in rodent malaria (Plasmodium yoelii 17XL) infection
Journal Parasitology International
Volume
Page
Year 2022
PMID


Disease , Applicable field information

Disease name, Applicable field infectious






Copyright @ 2021 Kumamoto University. All rights reserved.