CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3163
Type of strain Gene trap.
Strain name B6;Cg-Trp53cor1Gt(pU-21B)186Imeg
Internal Code Ayu21-B186, N18
Submitter Araki Kimi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Division of Developmental Genetics, Institute of Resource Development and Analysis, Kumamoto University
Organization code CARD
Developer Kimi Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Trp53cor1
Gene name tumor protein p53 pathway corepressor 1
Allele symbol Trp53cor1Gt(Ayu21-B186)Imeg
Allele name tumor protein p53 pathway corepressor 1; gene trap Ayu21-B186, Institute of Molecular Embryology and Genetics
MGI MGI:3801771,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
B186-G2 CCGAGCTGTCTATTCCTCAG
B186-G4 CAGCTCCCACCAATGGAATG
SA-5'AS GGGCAAGAACATAAAGTGACC


References

Author Riki Furuhata, Mai, Imasaka, Michihiko Sugimoto, Kumiko Yoshinobu, Masatake Araki, Kimi Araki
Title LincRNA-p21 exon1 expression correlates with Cdkn1a expression in vivo
Journal Genes Cells
Volume
Page
Year
PMID 34808017


Disease , Applicable field information

Disease name, Applicable field Cell biology, Development, Molecular biology






Copyright @ 2021 Kumamoto University. All rights reserved.