| CARD ID | 3163 | |
| Type of strain | Gene trap. | |
| Strain name | B6;Cg-Trp53cor1Gt(pU-21B)186Imeg | |
| Internal Code | Ayu21-B186, N18 | |
| Submitter | Araki Kimi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Division of Developmental Genetics, Institute of Resource Development and Analysis, Kumamoto University |
| Organization code | CARD | |
| Developer | Kimi Araki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Trp53cor1 |
| Gene name | tumor protein p53 pathway corepressor 1 |
| Allele symbol | Trp53cor1Gt(Ayu21-B186)Imeg |
| Allele name | tumor protein p53 pathway corepressor 1; gene trap Ayu21-B186, Institute of Molecular Embryology and Genetics |
| MGI | MGI:3801771, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| B186-G2 | CCGAGCTGTCTATTCCTCAG |
| B186-G4 | CAGCTCCCACCAATGGAATG |
| SA-5'AS | GGGCAAGAACATAAAGTGACC |
| Author | Riki Furuhata, Mai, Imasaka, Michihiko Sugimoto, Kumiko Yoshinobu, Masatake Araki, Kimi Araki |
| Title | LincRNA-p21 exon1 expression correlates with Cdkn1a expression in vivo |
| Journal | Genes Cells |
| Volume | |
| Page | |
| Year | |
| PMID | 34808017 |
| Disease name, Applicable field | Cell biology, Development, Molecular biology |