CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3161
Type of strain Targeted mutant.
Strain name C57BL/6-Ccdc158em1
Internal Code Ccdc158
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Ccdc158
Gene name coiled-coil domain containing 158
Allele symbol Ccdc158em1
Allele name coiled-coil domain containing 158; endonuclease-mediated mutation 1,
MGI MGI:2444555,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Primer1(Ccdc158-F2) GCTATGGATCTCTTACCAGTCTGTC
Primer2(Ccdc158-R3) CTCGGAGAATCAAGTTCCACTTC
PCR Primer 2
Primer1 (Ccdc158_F2) GCTATGGATCTCTTACCAGTCTGTC
Primer2 (Ccdc158_R2) CTAAGCAGCTGTGTCTCCATGAC


Disease , Applicable field information

Disease name, Applicable field Reproduction, Cell biology






Copyright @ 2021 Kumamoto University. All rights reserved.