CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3160
Type of strain Targeted mutant.
Strain name C57BL/6-Gm28536em1
Internal Code Gm28536_del1
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gm28536
Gene name predicted gene 28536
Allele symbol Gm28536em1
Allele name predicted gene 28536; endonuclease-mediated mutation 1,
MGI MGI:5579242,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Gm28536_F3 actgtactccttcgcaattcatagctc
Gm28536_R3 GACTCCTAGTCCCACAGAGCTTC


Disease , Applicable field information

Disease name, Applicable field Reproduction, Cell biology






Copyright @ 2021 Kumamoto University. All rights reserved.