| CARD ID | 3159 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Cthtm1, Mpsttm1 | |
| Internal Code | C57BL/6-Cth(tm1)/Mpst(tm1) | |
| Submitter | ISHII ISAO | |
| Submitter affiliation or code | Showa Pharmaceutical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Showa Pharmaceutical University |
| Organization code | ||
| Developer | Isao Ishii | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cth |
| Gene name | cystathionase (cystathionine gamma-lyase) |
| Allele symbol | Cthtm1 |
| Allele name | cystathionase (cystathionine gamma-lyase); targeted mutation 1, |
| MGI | MGI:1339968, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Gene symbol | Mpst |
| Gene name | Mercaptopyruvate sulfurtransferase |
| Allele symbol | Mpsttm1 |
| Allele name | Mercaptopyruvate sulfurtransferase; targeted mutation 1, |
| MGI | MGI:2179733, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| CSE-F2 | TGCCGACCAATAAGCAGGGC |
| CSE-PCR-2 | CCAGACCGGCAACGAAAATCA |
| MPST-3 | GCATATAAGGCCAGCACACG |
| MPST-7 | AGCTGGGCTACATCTTAGAGA |
| Author | Isao Ishii, Noriyuki Akahoshi, Hidenori Yamada, Shintaro Nakano, Takashi Izumi, and Makoto Suematsu |
| Title | Cystathionine gamma-Lyase-deficient Mice Require Dietary Cysteine to Protect against Acute Lethal Myopathy and Oxidative Injury |
| Journal | J. Biol. Chem. |
| Volume | 285 |
| Page | 26358-26368 |
| Year | 2010 |
| PMID |
| Author | Akahoshi, N., Minakawa, T., Miyashita, M., Sugiyama, U., Saito, C., Takemoto, R., Honda, A., Kamichatani, W., Kamata, S., Anan, Y., Ishii, I. |
| Title | Increased Urinary 3-Mercaptolactate Excretion and Enhanced Passive Systemic Anaphylaxis in Mice Lacking Mercaptopyruvate Sulfurtransferase, a Model of Mercaptolactate-Cysteine Disulfiduria. |
| Journal | Int J Mol Sci |
| Volume | 21 |
| Page | 818; doi:10.3390/ijms21030818 |
| Year | 2020 Jan 27 |
| PMID |
| Disease name, Applicable field | Hematology, Digestive Disorders, Metabolism, Diabetes, Physiology |