CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3159
Type of strain Targeted mutant.
Strain name C57BL/6-Cthtm1, Mpsttm1
Internal Code C57BL/6-Cth(tm1)/Mpst(tm1)
Submitter ISHII ISAO
Submitter affiliation or code Showa Pharmaceutical University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Showa Pharmaceutical University
Organization code
Developer Isao Ishii
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Cth
Gene name cystathionase (cystathionine gamma-lyase)
Allele symbol Cthtm1
Allele name cystathionase (cystathionine gamma-lyase); targeted mutation 1,
MGI MGI:1339968,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM
Gene symbol Mpst
Gene name Mercaptopyruvate sulfurtransferase
Allele symbol Mpsttm1
Allele name Mercaptopyruvate sulfurtransferase; targeted mutation 1,
MGI MGI:2179733,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
CSE-F2 TGCCGACCAATAAGCAGGGC
CSE-PCR-2 CCAGACCGGCAACGAAAATCA
PCR Primer 2
MPST-3 GCATATAAGGCCAGCACACG
MPST-7 AGCTGGGCTACATCTTAGAGA


References

Author Isao Ishii, Noriyuki Akahoshi, Hidenori Yamada, Shintaro Nakano, Takashi Izumi, and Makoto Suematsu
Title Cystathionine gamma-Lyase-deficient Mice Require Dietary Cysteine to Protect against Acute Lethal Myopathy and Oxidative Injury
Journal J. Biol. Chem.
Volume 285
Page 26358-26368
Year 2010
PMID
Author Akahoshi, N., Minakawa, T., Miyashita, M., Sugiyama, U., Saito, C., Takemoto, R., Honda, A., Kamichatani, W., Kamata, S., Anan, Y., Ishii, I.
Title Increased Urinary 3-Mercaptolactate Excretion and Enhanced Passive Systemic Anaphylaxis in Mice Lacking Mercaptopyruvate Sulfurtransferase, a Model of Mercaptolactate-Cysteine Disulfiduria.
Journal Int J Mol Sci
Volume 21
Page 818; doi:10.3390/ijms21030818
Year 2020 Jan 27
PMID


Disease , Applicable field information

Disease name, Applicable field Hematology, Digestive Disorders, Metabolism, Diabetes, Physiology






Copyright @ 2021 Kumamoto University. All rights reserved.