CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3149
Type of strain Targeted mutant.
Strain name B6-Rbm12em3Card
Internal Code Rbm12-17
Submitter Araki Kimi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Rbm12
Gene name RNA binding motif protein 12
Allele symbol Rbm12em3Card
Allele name RNA binding motif protein 12; endonuclease-mediated mutation 3, Center for Animal Resources and Development,
MGI MGI:1922960,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Rbm12-S2 GAACCCTCCAGAAGCAATAAAG
Rbm12-AS1 GGATCTTTGGAGTATTAGACTG


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.