| CARD ID | 3149 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6-Rbm12em3Card | |
| Internal Code | Rbm12-17 | |
| Submitter | Araki Kimi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Rbm12 |
| Gene name | RNA binding motif protein 12 |
| Allele symbol | Rbm12em3Card |
| Allele name | RNA binding motif protein 12; endonuclease-mediated mutation 3, Center for Animal Resources and Development, |
| MGI | MGI:1922960, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Rbm12-S2 | GAACCCTCCAGAAGCAATAAAG |
| Rbm12-AS1 | GGATCTTTGGAGTATTAGACTG |
| Disease name, Applicable field |