CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3096
Type of strain Targeted mutant.
Strain name C57BL/6J-Hmgcs2em1
Internal Code Hmgcs2 KO
Submitter Yuichiro Arima
Submitter affiliation or code International Research Center for Medical Science(IRCMS), Kumamoto University
Stock Type
Material Transfer Conditions
Production method in-house breeding
Origin (In-house) Organization Kumamoto University
Organization code
Developer Arima Yuichiro
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Hmgcs2
Gene name 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
Allele symbol Hmgcs2em1
Allele name 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2; endonuclease-mediated mutation 1,
MGI MGI:101939,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
Primer1 ggtgcttgtctgggagtga
Primer2 cttagagatgcagcggcttt


References

Author Yuichiro Arima, Yoshiko Nakagawa, Toru Takeo, Toshifumi Ishida, Toshihiro Yamada, Shinjiro Hino, Mitsuyoshi Nakao, Sanshiro Hanada, Terumasa Umemoto, Toshio Suda, Tetsushi Sakuma, Takashi Yamamoto, Takehisa Watanabe, Katsuya Nagaoka, Yasuhito Tanaka, Yumiko K Kawamura, Kazuo Tonami, Hiroki Kurihara, Yoshifumi Sato, Kazuya Yamagata, Taishi Nakamura, Satoshi Araki, Eiichiro Yamamoto, Yasuhiro Izumiya, Kenji Sakamoto, Koichi Kaikita, Kenichi Matsushita, Koichi Nishiyama, Naomi Nakagata, Kenichi Tsujita
Title Murine neonatal ketogenesis preserves mitochondrial energetics by preventing protein hyperacetylation
Journal Nature metabolism
Volume 3
Page 196–210
Year 2021
PMID 33619377


Disease , Applicable field information

Disease name, Applicable field Digestive Disorders, Metabolism, Development, Behavior






Copyright @ 2021 Kumamoto University. All rights reserved.