| CARD ID | 3086 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Kctd19em1 Zfp541em1 | |
| Internal Code | Zfp541#16/Kctd19#12 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Zfp541 |
| Gene name | zinc finger protein 541 |
| Allele symbol | Zfp541em4 |
| Allele name | zinc finger protein 541; endonuclease-mediated mutation 4, |
| MGI | MGI:3647699, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Gene symbol | Kctd19 |
| Gene name | Kctd19 |
| Allele symbol | Kctd19em1 |
| Allele name | potassium channel tetramerisation domain containing 19; emdonuclease-mediated mutation 1 |
| MGI | MGI:3045294, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| ZFP541-F1 | agctagctgccagcgagggctcttc |
| ZFP541-R2 | tggttgagtgtgtcactgcagttgag |
| ZFP541-R3 | gaggcagcagaagggaggtaggatg |
| KCTD19-F4 | GGACTTCCAGGAATGCAGTGACAGG |
| KCTD19-R3 | TGGCTTAAAGGTTGGCTCTGGACCC |
| KCTD19-F3 | TAAAATACCGTCCCAAAGCAAGTCAC |
| KCTD19-R1 | TTTCCCATGCCACCTGTGCCTTTCC |
| Author | Horisawa-Takada Y, Kodera C, Takemoto K, Sakashita A, Horisawa K, Maeda R, Usuki S, Fujimura S, Tani N, Matsuura K, Shimada R, Akiyama T, Suzuki A, Niwa H, Tachibana M, Ohba T, Katabuchi H, Namekawa S, Araki K, Ishiguro K |
| Title | Meiosis-specific ZFP541 repressor complex promotes developmental progression of meiotic prophase towards completion during mouse spermatogenesis |
| Journal | Nature Communications |
| Volume | In press |
| Page | |
| Year | 2021 |
| PMID |
| Disease name, Applicable field | Reproduction, Cell biology |