CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3084
Type of strain Targeted mutant.
Strain name Zfp541#16/REC8-3XFLAG-HA-p2A-GFP KI
Internal Code Zfp541#16/REC8-3XFLAG-HA-p2A-GFP KI
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Rec8
Gene name REC8 meiotic recombination protein
Allele symbol
Allele name
MGI
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
68_Rec8-Left2-F GTCGACTGAGCAAGTTCATTAAACCATATCCTG
85_Rec8-Rightarm-R GCGGCCGCTCTTGAAGCTGACATCTTTGGTTAC
PCR Primer 2
ZFP541-F1 agctagctgccagcgagggctcttc
ZFP541-R2 tggttgagtgtgtcactgcagttgag
ZFP541-R3 gaggcagcagaagggaggtaggatg


References

Author Horisawa-Takada Y, Kodera C, Takemoto K, Sakashita A, Horisawa K, Maeda R, Shimada R, Usuki S, Fujimura S, Tani N, Matsuura K, Akiyama T, Suzuki A, Niwa H, Tachibana M, Ohba T, Katabuchi H, Namekawa S, Araki K, Ishiguro K.
Title Meiosis-specific ZFP541 repressor complex promotes developmental progression of meiotic prophase towards completion during mouse spermatogenesis
Journal Nature Communications
Volume 12, 3184
Page DOI : 10.1038/s41467-021-23378-4
Year 2021
PMID


Disease , Applicable field information

Disease name, Applicable field Reproduction, Cell biology, Molecular biology






Copyright @ 2021 Kumamoto University. All rights reserved.