| CARD ID | 3081 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Gt(ROSA)26Sorem1(Stra8-Meiosin)/31 | |
| Internal Code | Rosa26-frox Kusabira-Stra8-p2A-Meiosin- Line #31 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
Collaboration permission is required for usage of this line |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Chromosome Biology Institute of Molecular Embryology and Genetics, Kumamoto University |
| Organization code | ||
| Developer | Kei-ichiro Ishiguro | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Rosa26 |
| Gene name | Rosa26 |
| Allele symbol | Stra8tm1(GFP) |
| Allele name | Stimulated by retinoids acid 8, targeted mutation 1, |
| MGI | MGI:107917, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| S8-1F | GTGCCTGGAGACCTTTGACGATCTG |
| Gm-1R | gcttgagcaaggccttggtcatgtc |
| Author | Ishiguro K, Matsuura K, Tani N, Takeda N, Usuki S, Yamane M, Sugimoto M, Fujimura S, Hosokawa M, Chuma S, Ko S.H.M, Araki K, Niwa H. |
| Title | MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells. |
| Journal | Dev. Cell |
| Volume | 52(4) |
| Page | 429-445 |
| Year | 2020 |
| PMID |
| Disease name, Applicable field | Molecular biology |