| CARD ID | 3012 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Meiosinem1/2 | |
| Internal Code | Meiosin dHLH - Line #2 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Meiosin |
| Gene name | meiosis initiator |
| Allele symbol | Meiosinem1 |
| Allele name | meiosis initiator; endonuclease-mediated mutation 1, |
| MGI | MGI:3647482, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Gm4969-13926F | GTCCTATTTTAGGAACTCTAGGTGC |
| MeiosindelHLH-1R | CAGGAAGGGGAAGGTAGCCAATTGG |
| Gm4969-14136R | GTAGAGAACAATTACCTGTCAGTAGG |
| Author | Ishiguro K, Matsuura K, Tani N, Takeda N, Usuki S, Yamane M, Sugimoto M, Fujimura S, Hosokawa M, Chuma S, Ko S.H.M, Araki K, Niwa H. |
| Title | MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells. |
| Journal | Dev. Cell |
| Volume | 52(4) |
| Page | 429-445 |
| Year | 2020 |
| PMID |
| Disease name, Applicable field | Reproduction, Cell biology |