| CARD ID | 3001 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Tex47tm1 | |
| Internal Code | DYBLUP | |
| Submitter | Takeda Sen | |
| Submitter affiliation or code | National University Corporation university of Yamanashi | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Experimental Genome Research, Research Institution for Microbial Diseases, Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Tex47 |
| Gene name | testis expressed 47 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1918170, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Tex47_forward | AAGCTAGCGTGAACTCAGAAGCAATGGCTG |
| Tex47_reverse | AAGTCGACGTGTTAATTCCCTTCCATCTAT |
| Disease name, Applicable field | Behavior, Anatomy, Physiology, Cell biology, Neurobiology, Development |