CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3001
Type of strain Targeted mutant.
Strain name C57BL/6-Tex47tm1
Internal Code DYBLUP
Submitter Takeda Sen
Submitter affiliation or code National University Corporation university of Yamanashi
Stock Type
Material Transfer Conditions Others
Production method in-house breeding
Origin (In-house) Organization Department of Experimental Genome Research, Research Institution for Microbial Diseases, Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tex47
Gene name testis expressed 47
Allele symbol
Allele name
MGI MGI:1918170,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Tex47_forward AAGCTAGCGTGAACTCAGAAGCAATGGCTG
Tex47_reverse AAGTCGACGTGTTAATTCCCTTCCATCTAT


Disease , Applicable field information

Disease name, Applicable field Behavior, Anatomy, Physiology, Cell biology, Neurobiology, Development






Copyright @ 2021 Kumamoto University. All rights reserved.