CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2999
Type of strain Targeted mutant.
Strain name C57BL/6-Meiosinem1(Meiosin-3xFLAG-HA)
Internal Code Meiosin-3FH KI
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Meiosin
Gene name meiosis initiator
Allele symbol Meiosinem1(Meiosin-3xFLAG-HA)
Allele name meiosis initiator; endonuclease-mediated mutation 1,
MGI MGI:3647482,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Gm4969-29318F CACTAAGGCACGCAGGTTCAGCCGC
Gm4969-29964R GAGGTAAAGGGTTTGAGTTCAGACC


Disease , Applicable field information

Disease name, Applicable field Cell biology, Reproduction


EGTC

EGTC番号




Copyright @ 2021 Kumamoto University. All rights reserved.