| CARD ID | 2995 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6J-Tg(Atp1a2M731T)6999Kwk | |
| Internal Code | Atp1a2M731T6999 | |
| Submitter | SUGIMOTO HIROKI | |
| Submitter affiliation or code | Center for Molecular Medicine, Jichi Medical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Atp1a2 |
| Gene name | ATPase Na+/K+ transporting, alpha 2 polypeptide |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| 731F2 | CAGCTGGATGAGATCCTCAG |
| 731mutR6 | AGCCGGAGATGCCCG |
| Disease name, Applicable field | Physiology, Behavior, Laboratory-animal Science, Neurobiology |